The full text of this article hosted at iucr.org is unavailable due to technical difficulties.

Cartilage Biology
Free Access

Water‐soluble C60 fullerene prevents degeneration of articular cartilage in osteoarthritis via down‐regulation of chondrocyte catabolic activity and inhibition of cartilage degeneration during disease development

Kazuo Yudoh

Corresponding Author

E-mail address:yudo@marianna‐u.ac.jp

St. Marianna University School of Medicine, Kawasaki, Japan

St. Marianna University School of Medicine, 2‐16‐1 Sugao, Miyamae‐ku, Kawasaki, Kanagawa 216‐8512, Japan
Search for more papers by this author
Kiyoshi Shishido

Mitsubishi Corporation, Tokyo, Japan

Search for more papers by this author
Hideki Murayama

Mitsubishi Corporation, Tokyo, Japan

Search for more papers by this author
Mitsunobu Yano

Mitsubishi Corporation, Tokyo, Japan

Search for more papers by this author
Kenji Matsubayashi

Vitamin C60 BioResearch Corporation, Tokyo, Japan

Search for more papers by this author
Hiroya Takada

Vitamin C60 BioResearch Corporation, Tokyo, Japan

Search for more papers by this author
Hiroshi Nakamura

Nippon Medical School, Tokyo, Japan

Search for more papers by this author
Kayo Masuko

St. Marianna University School of Medicine, Kawasaki, Japan

Search for more papers by this author
Tomohiro Kato

St. Marianna University School of Medicine, Kawasaki, Japan

Search for more papers by this author
Kusuki Nishioka

St. Marianna University School of Medicine, Kawasaki, Japan

Search for more papers by this author
First published: 28 September 2007
Cited by: 43

Abstract

Objective

Studies have shown the roles of oxidative stress in the pathogenesis of osteoarthritis (OA) and induction of chondrocyte senescence during OA progression. The aim of this study was to examine the potential of a strong free‐radical scavenger, water‐soluble fullerene (C60), as a protective agent against catabolic stress–induced degeneration of articular cartilage in OA, both in vitro and in vivo.

Methods

In the presence or absence of C60 (100 μM), human chondrocytes were incubated with interleukin‐1β (10 ng/ml) or H2O2 (100 μM), and chondrocyte activity was analyzed. An animal model of OA was produced in rabbits by resection of the medial meniscus and medial collateral ligament. Rabbits were divided into 5 subgroups: sham operation or treatment with C60 at 0.1 μM, 1 μM, 10 μM, or 40 μM. The left knee joint was injected intraarticularly with water‐soluble C60 (2 ml), while, as a control, the right knee joint received 50% polyethylene glycol (2 ml), once weekly for 4 weeks or 8 weeks. Knee bone and cartilage tissue were prepared for histologic analysis. In addition, in the OA rabbit model, the effect of C60 (10 μM) on degeneration of articular cartilage was compared with that of sodium hyaluronate (HA) (5 mg/ml).

Results

C60 (100 μM) inhibited the catabolic stress–induced production of matrix‐degrading enzymes (matrix metalloproteinases 1, 3, and 13), down‐regulation of matrix production, and apoptosis and premature senescence in human chondrocytes in vitro. In rabbits with OA, treatment with water‐soluble C60 significantly reduced articular cartilage degeneration, whereas control knee joints showed progression of cartilage degeneration with time. This inhibitory effect was dose dependent, and was superior to that of HA. Combined treatment with C60 and HA yielded a significant reduction in cartilage degeneration compared with either treatment alone.

Conclusion

The results indicate that C60 fullerene is a potential therapeutic agent for the protection of articular cartilage against progression of OA.

During the development of osteoarthritis (OA), mechanical and chemical stresses on articular cartilage change the stable cellular activities of chondrocytes and stimulate the production of growth factors and matrix proteins as well as inflammation mediators (1-4). It is well known that catabolic‐stressed chondrocytes produce excess amounts of reactive oxygen species (ROS) (superoxide, nitric oxide, hydrogen peroxide, and peroxynitrite) as well as proinflammatory cytokines and chemokines (4-9).

Studies have provided ample confirmation of the generation of ROS and the depletion of cellular antioxidants in degenerated articular cartilage (8-10). Numerous reports have indicated that the degeneration of articular cartilage is partially mediated by oxygen‐derived free radicals (8-12). Kurz et al reported that the extent of mechanical stress on articular cartilage is sufficient to stimulate an excess production of ROS from chondrocytes, leading to depolymerization of hyaluronic acid and chondrocyte death (11, 12). Similarly, Green et al demonstrated that chondrocyte death is induced by adherence of inflammatory leukocytes to chondrocytes and by excess production of ROS from chondrocytes in response to mechanical stress to the cartilage (13). These reports clearly indicate that chronic excess production of ROS from chondrocytes, which is induced by mechanical force exerted on the cartilage, plays an important role in the cartilage degeneration that occurs after mechanical injury (10-13).

There is a general consensus that a strong association exists between age and the incidence and prevalence of OA (8, 14-19). Martin et al demonstrated that aging decreases the ability of chondrocytes to maintain and repair articular cartilage (15, 16). These findings suggest that the association between OA and aging is due, at least in part, to age‐related loss of chondrocyte and matrix functions. In addition, it is thought that aged chondrocytes show an insufficient response to anabolic factors, which leads to continuous matrix degradation as a result of an imbalance in catabolic and anabolic activities (14, 20-22).

Recent reports also revealed that chondrocyte aging is closely involved in oxidative stress, such as the induction of ROS by extrinsic stress (e.g., mechanical force) in degenerated articular cartilage (11-13, 19, 23). It has been reported that oxygen‐derived free radicals directly damage the guanine repeats in the telomere DNA (24-27). This means that oxidative stress leads to telomere erosion, with no requirement for cell division, resulting in cellular senescence. The evidence for chondrocyte aging caused by ROS in OA cartilage suggests that oxidative stress is, at least in part, implicated in the development of OA.

In addition to mechanical forces and aging, inflammation is involved in the pathogenesis of articular cartilage degeneration. Proinflammatory cytokines and chemokines, which are implicated in the progression of arthritis, have been demonstrated to induce the production of ROS in a variety of cells (28-31). In addition, it has been reported that receptor‐mediated ROS generation is an upstream event in the activation of the MAPKs phosphatidylinositol 3‐kinase and NF‐κB (28, 31, 32). ROS could have an important role in the acceleration of the effects of mechanical forces and aging in cartilage, which lead to a proinflammatory state and an imbalance of catabolic and anabolic activities in articular cartilage. Targeting of ROS could, therefore, have a distinct therapeutic value as a strategy to prevent cartilage degeneration.

Fullerene (C60) is known as a spheric carbon molecule with a unique cage structure (33, 34), and is characterized as a strong radical sponge (35). This compound has high reactivity with oxygen‐derived free radicals and functions potentially as a free‐radical scavenger. It has been reported that the antioxidant level of C60 fullerene is several hundred–fold higher than that of other antioxidants (35).

Recent studies have shown that fullerene derivatives have some remarkable biologic properties, such as inhibition of the activity of human immunodeficiency virus type 1 (36), promotion of chondrogenesis (37), membranotropic properties, and activation of transmembrane transport of bivalent metal ions (38). In addition, fullerene inhibits neuronal apoptosis by scavenging ROS (39), and protects human skin keratinocytes from ROS‐induced cell death after ultraviolet stress (40). These findings suggest that fullerene is a useful agent in protecting against the oxygen‐derived free radical–induced pathologic features in a variety of diseases (41). Exploitation of fullerene could lead to the development of novel therapeutic strategies in the prevention of both chondrocyte aging and cartilage degeneration.

In addition to inhibiting ROS‐induced catabolic activity in articular cartilage, there is a potential for C60 to decrease friction on the cartilage surface. Recently, it has been demonstrated that fullerene serves a lubricant function, being described as a “molecular bearing” with superlubricity (42, 43). Reducing the friction on joint surfaces may prevent the further development of cartilage degeneration (44). These findings demonstrate the potential for C60 to reduce friction on the surface of articular cartilage by acting as a lubricating fluid in the joint.

In the present study we demonstrated, in vitro and in vivo, that water‐soluble C60 fullerene, a strong free radical scavenger, can function as a protective agent against catabolic stress–induced degeneration of articular cartilage in OA. Our findings confirm that C60 inhibits the catabolic stress–induced production of matrix‐degrading enzymes, the down‐regulated production of matrix proteins, cellular senescence, and apoptosis of chondrocytes in vitro. Furthermore, in a rabbit model of OA produced by resection of both the medial meniscus and medial collateral ligament, we found that this compound significantly reduced articular cartilage degeneration. We also used the rabbit model of OA to compare the therapeutic effect of C60 on cartilage degeneration with that of sodium hyaluronate (HA), another compound that shows high viscosity, retains moisture, and has lubricating, coating, and joint‐protecting functions (44, 45). Our results indicate that C60 fullerene may be useful as a therapeutic agent in the protection of articular cartilage against degeneration in patients with OA.

PATIENTS AND METHODS

Chondrocyte isolation.

Human articular cartilage samples were obtained during arthroplastic knee surgery from the knee joints of patients with OA (n = 7, ages 66–84 years). Informed consent was obtained from all patients, and all samples were obtained in accordance with our institution's protocol, with review board approval. Donor articular cartilage samples were evaluated macroscopically to confirm the diagnosis of knee OA.

OA cartilage tissues were cut into small pieces, washed with phosphate buffered saline (PBS), and digested with 1.5 mg/ml collagenase B (Sigma, St. Louis, MO) in Dulbecco's modified Eagle's medium (DMEM; Sigma). Digestion was carried out overnight at 37°C on a shaking platform. Cells were centrifuged, washed 3 times with PBS, resuspended, and cultured in DMEM supplemented with 10% heat‐inactivated fetal calf serum, 2 mM L‐glutamine, 25 mM HEPES (2‐[4‐(2‐hydroxyethyl)‐1‐piperazinyl] ethanesulfonic acid), and 100 units/ml penicillin and streptomycin, at 37°C in a humidified atmosphere of 95% air and 5% CO2.

Chondrocyte culture under hypoxic conditions.

It is well known that chondrocytes can adapt to hypoxic conditions, since articular cartilage is an avascular tissue (10, 19). Thus, chondrocyte activity was studied under hypoxic, as well as normoxic, culture conditions in vitro. Human chondrocytes were seeded on 10‐cm culture plates. The plates were placed in a sealed hypoxia chamber (Billups‐Rothenberg, Del Mar, CA) equilibrated with certified gas containing 1% O2, 5% CO2, and 94% N2. In this hypoxia chamber system, an O2 tension lower than ∼6% was observed after 20 minutes of gas flow (20 liters/minute) (10, 46). The O2 tension in the culture medium was monitored with an oxygen meter (Fuso Rekaseihin, Tokyo, Japan). In control experiments (normoxic conditions), the cells were incubated in a humidified atmosphere of 95% air and 5% CO2.

In the presence or absence of recombinant human interleukin‐1β (IL‐1β) (10 ng/ml; Sigma) or H2O2 (100 μM; Wako Pure Industries, Tokyo, Japan), water‐soluble C60 (100 μM; purchased from Vitamin C60 Bio Research, Tokyo, Japan) (47, 48) was added, and the cells were incubated under normoxic or hypoxic culture conditions. After the incubation period, the supernatant and cells were collected for enzyme‐linked immunosorbent assay (ELISA) and Western blot analysis, respectively.

Measurement of anabolic and catabolic activity of chondrocytes.

To examine the effect of C60 on anabolic activity in chondrocytes, the levels of proteoglycan produced by chondrocytes were measured in chondrocyte cell cultures using an ELISA kit, in accordance with the manufacturer's protocol (BioSource Europe, Nivelles, Belgium). For measuring the catabolic activity of chondrocytes, levels of matrix metalloproteinases (MMPs) 1, 3, and 13 produced by chondrocytes were measured using an ELISA kit (ELISAs for MMP‐1 and MMP‐13 from Amersham Biosciences, Buckinghamshire, UK; MMP‐3 ELISA from R&D Systems, Minneapolis, MN). Data from 4 independent experiments were analyzed.

Immunoblotting.

To investigate the effect of C60 on chondrocyte activity, the level of type II collagen production by chondrocytes was analyzed by Western blotting. After treatment of cultured chondrocytes with C60, chondrocytes were lysed in boiling sample buffer, as suggested by the manufacturer (Sigma). Samples were then homogenized by repeated aspiration through a 26‐gauge needle. Cellular proteins were resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (12.5% acrylamide) and were transferred to nitrocellulose membranes. Blots were incubated for 2 hours in Tris buffered saline/Tween 20 (TBST; 10 mM Tris HCl, pH 8.0, 150 mM NaCl, and 0.2% Tween 20) containing 2% powdered skim milk and 1% bovine serum albumin. After 3 washes with TBST, membranes were incubated for 2 hours with the primary antibody to type II collagen (diluted 500‐fold in TBST) (Chemicon International, Temecula, CA) and for 1 hour with horseradish peroxidase–conjugated goat anti‐IgG (diluted 1,000‐fold) (Dako, Glostrup, Denmark). Bound antibodies were detected using an enhanced chemiluminescence detection kit (Amersham Biosciences). The signal bands were analyzed by densitometry with Image Gauge, version 4.0 (Fuji Photo Film, Tokyo, Japan).

Reverse transcription–polymerase chain reaction (RT‐PCR) and quantitative real‐time RT‐PCR.

Total RNA was extracted from chondrocytes by acid guanidine–phenol–chloroform extraction using Isogen (Nippon Gene, Toyama, Japan). RNA was evaluated spectrophotometrically for quantity and purity. First‐strand complementary DNA (cDNA) was synthesized from isolated RNA with 0.5 mM dNTP, 10 mM dithiothreitol, 15 ng/μl of random primers (hexamers), 2 units/μl of ribonuclease inhibitor, and 10 units/μl of Superscript II reverse transcriptase, and used as templates for PCR. The PCR amplification was performed using specific primers. The sequences of the primers were as follows: for MMP‐1, forward CTGTTCAGGGACAGAATGTGCT, reverse TCGATATGCTTCACAGTTCTAGGG; for MMP‐3, forward CTCACAGACCTGACTCGGTT, reverse CACGCCTGAAGGAAGAGATG; and for MMP‐13, forward TCCTCTTCTTGAGCTGGACTCATT, reverse CGCTCTGCAAACTGGAGGTC. The constitutively expressed gene encoding GAPDH was used as an internal control in RT‐PCR to normalize the amounts of messenger RNA (mRNA) in each sample. The PCR products were analyzed by electrophoresis in 2% agarose gels stained with ethidium bromide, and bands were visualized and photographed under ultraviolet excitation.

Quantitative real‐time RT‐PCR was performed with a spectrofluorometric LightCycler (Roche, Heidelberg, Germany) using FastStart DNA Master SYBR Green I. Specificity of the expected products was demonstrated by melting curves analysis. To standardize mRNA levels, GAPDH was amplified as an internal control. Normalized gene expression was calculated as the ratio between the copy number of the gene of interest and that of GAPDH cDNA.

Detection of chondrocyte apoptosis.

Human subconfluent chondrocytes were cultured with 10 ng/ml IL‐1β in the presence or absence of C60 (100 μM) for 24 hours under the normoxic condition described above. Chondrocyte apoptosis was detected using an apoptosis detection kit (terminal deoxynucleotidyl transferase [TdT] in situ apoptosis detection kit; R&D Systems) in chondrocyte cell cultures, in accordance with the manufacturer's protocol. The kit was used to identify apoptotic chondrocytes by detecting DNA fragmentation through a combination of enzymology and immunohistochemistry techniques (19). Biotinylated nucleotides are incorporated into the 3′‐OH ends of the DNA fragments by TdT. Cells containing fragmented nuclear chromatin, characteristic of apoptosis, exhibit a brown nuclear staining. The levels of apoptosis were assessed by measuring the percentage of apoptotic nuclei in each sample.

Detection of chondrocyte senescence.

Chondrocyte senescence was analyzed by senescence‐associated β‐galactosidase (SA‐β‐Gal) activity assay (49). The chondrocytes were cultured under the normoxic condition, in the presence of IL‐1β. After stimulation with 10 ng/ml IL‐1β for 5 days, cellular SA‐β‐Gal activity was detected using the Senescence Detection Kit (BioVision, Mountain View, CA) according to the manufacturer's recommendations. The SA‐β‐Gal–positive cells per field were counted under reflected light, using a digital high‐fidelity microscope (VH‐8000, 200× magnification; Keyence, Osaka, Japan).

Rabbit model of OA.

NZW rabbits (weighing 2–2.5 kg; Kitayama, Tokyo, Japan) were anesthetized by intramuscular injection of ketamine (100 mg/kg; Pfizer, Tokyo, Japan) and xylazine (8 mg/kg; Bayer Health Care, Tokyo, Japan). The knee joint was shaved and disinfected with iodine solution (Isogene; Nippon Gene). An incision was made through the skin into the medial parapatellar region, and a medial arthrotomy was performed. The medial collateral ligament and medial meniscus were totally resected (50, 51). The joint was washed with sterile saline and the joint capsule was closed. The contralateral side was also subjected to the same surgical manipulation.

The knee joints of 32 rabbits were assessed. The rabbits were divided into the following 5 subgroups: sham operation group (n = 4), 0.1 μM C60–treated group (n = 7), 1 μM C60–treated group (n = 7), 10 μM C60–treated group (n = 7), and 40 μM C60–treated group (n = 7). In each rabbit after surgical treatment, the left knee joint was treated with an intraarticular injection of the appropriate C60 solution (2 ml of 0.1–40 μM C60 in 50% polyethylene glycol [PEG]) by 26‐gauge needle, administered once per week for 4 or 8 weeks. The right knee joint was treated with an intraarticular injection of 50% PEG (2 ml) as a control, once per week for 4 or 8 weeks.

The rabbits were killed at 4 weeks or 8 weeks after surgery, and both knee joints were harvested. Bone and cartilage tissue blocks were prepared for histologic analysis. All experiments were conducted with the approval of the St. Marianna University Animal Care and Use Committee.

To compare the therapeutic effect of C60 with that of HA, 24 rabbits in the OA model were used. These rabbits with OA were divided into the following 3 subgroups: 5 mg/ml HA–treated group (n = 4) (Chugai Pharmaceutical, Tokyo, Japan), 10 μM C60–treated group (n = 4), and 10 μM C60 plus 5 mg/ml HA–treated group (n = 4). Sham‐operated rabbits were also divided into 3 groups: no injection group (n = 4), 5 mg/ml HA–treated group (n = 4), and 10 μM C60–treated group (n = 4). In each rabbit after surgical treatment, the left knee joint was treated with an intraarticular injection of the appropriate solution (2 ml), once per week for 8 weeks. The right knee joint was treated with an intraarticular injection of 50% PEG (2 ml) as a control, once per week for 8 weeks.

The rabbits were killed 8 weeks after surgery, and both knee joints were harvested. Bone and cartilage tissue blocks were prepared for histologic analysis.

Articular cartilage lesion score.

Each cartilage sample was evaluated histologically for the degree of degeneration, with histologic features scored according to a modified Mankin grading system (50, 52) (Table 1). Articular cartilage samples together with subchondral bones were fixed for 2 days in 4% paraformaldehyde solution and then decalcified in 4% paraformaldehyde containing 0.85% sodium chloride and 10% acetic acid. The cartilage tissue was dehydrated in a series of ethanol solutions and infiltrated with xylene before being embedded in paraffin and cut into 6‐μm sections. Sections were deparaffinized through sequential immersion in xylene and a graded series of ethanol solutions, in accordance with conventional procedures. The sections were stained with Safranin O–fast green or hematoxylin and eosin. The mean ± SD articular cartilage lesion score was then determined for each group of animals (n = 6–8 samples per group). Three independent observers (KY, HN, and KM) assessed the extent of histologic cartilage damage, in a blinded manner.

Table 1. Criteria for histologic evaluation in a rabbit model of osteoarthritis
Safranin O–fast green staining
 0 = uniform staining throughout articular cartilage
 1 = loss of staining in the superficial zone for less than one‐half of the length of the plateau
 2 = loss of staining in the superficial zone for greater than or equal to one‐half of the length of the plateau
 3 = loss of staining in the superficial and middle zones for less than one‐half of the length of the plateau
 4 = loss of staining in the superficial and middle zones for greater than or equal to one‐half of the length of the plateau
 5 = loss of staining in all 3 zones for less than one‐half of the length of the plateau
 6 = loss of staining in all 3 zones for greater than or equal to one‐half of the length of the plateau
Chondrocyte loss
 0 = no decrease in cells
 1 = minimal decrease in cells
 2 = moderate decrease in cells
 3 = marked decrease in cells
 4 = very extensive decrease in cells
Structure
 0 = normal
 1 = surface irregularities
 2 = 1–3 superficial clefts
 3 = >3 superficial clefts
 4 = 1–3 clefts extending into the middle zone
 5 = >3 clefts extending into the middle zone
 6 = 1–3 clefts extending into the deep zone
 7 = >3 clefts extending into the deep zone
 8 = clefts extending to calcified cartilage

Statistical analysis.

Results are expressed as the mean ± SD. Data were analyzed by a nonparametric Mann‐Whitney U test. P values less than 0.05 were considered significant.

Student's t‐test was used to assess the differences between the C60‐treated and control groups with respect to histologic parameters (loss of Safranin O–fast green staining, structural changes, and chondrocyte loss [Table 1]) in the tibial plateau of each operated knee joint. When a statistically significant difference between the 2 groups was detected, analysis of variance was used to adjust for the confounding effects of variability in animals and observers.

RESULTS

Inhibitory effects of C60 on catabolic factor–induced production of matrix‐degrading enzymes.

Both catabolic factors, IL‐1β and H2O2, enhanced the production of MMPs 1, 3, and 13 by chondrocytes in control cultures, under both normoxic and hypoxic conditions. C60 at 100 μM significantly inhibited the IL‐1β– or H2O2‐induced excess production of MMPs 1, 3, and 13 from chondrocytes in normoxic culture conditions (Figures 1A–C). In addition, under hypoxic conditions, these 3 matrix‐degrading enzymes were significantly reduced in the presence of C60 (Figures 1A–C).

Effects of C60 on the production of matrix‐degrading enzymes in chondrocytes. A–C, Chondrocytes from patients with osteoarthritis (OA) (n = 7) were incubated with the catabolic factors interleukin‐1β (IL‐1β) (10 ng/ml) or H2O2 (100 μM), in the presence or absence of water‐soluble C60 (100 μM) under normoxic or hypoxic conditions. After 48 hours' incubation, the concentrations of matrix‐degrading enzymes (A, matrix metalloproteinase 1 [MMP‐1], B, MMP‐3, and C, MMP‐13) were analyzed by enzyme‐linked immunosorbent assay. D, Chondrocytes from patients with OA (n = 7) were incubated with IL‐1β (10 ng/ml) in the presence or absence of water‐soluble C60 (100 μM) under normoxic conditions. After 48 hours' incubation, expression of mRNA for MMPs 1, 3, and 13 in chondrocytes was analyzed by quantitative real‐time reverse transcription–polymerase chain reaction. Bars show the mean and SD from 4 independent experiments.

To further elucidate the effect of C60 on expression of MMPs, RT‐PCR and quantitative real‐time PCR analyses were performed to quantify the levels of mRNA for each of the MMPs in chondrocytes. As shown in Figure 1D, treatment with C60 significantly reduced the IL‐1β–enhanced expression of mRNA for MMPs 1, 3, and 13 in cultured chondrocytes.

Role of C60 in maintaining chondrocyte production of matrix components in response to catabolic stresses.

To examine the effect of C60 on chondrocyte production of matrix proteins, the amount of proteoglycan produced by cultured chondrocytes was measured. Under normoxic and hypoxic conditions, the amount of proteoglycan produced by chondrocytes was decreased following incubation with both catabolic factors, IL‐1β and H2O2 (P < 0.05 versus control under normoxic conditions, P < 0.01 versus control under hypoxic conditions) (Figure 2A). Treatment with C60 (100 μM) cancelled the catabolic stress (IL‐1β or H2O2)–induced decrease of proteoglycan production from chondrocytes, under both normoxic and hypoxic chondrocyte culture conditions (P < 0.05 versus control under hypoxic conditions, P < 0.01 versus IL‐1β or H2O2 alone under both normoxic and hypoxic conditions) (Figure 2A).

Effects of C60 on chondrocyte activity. Chondrocytes from patients with osteoarthritis (n = 7) were incubated with the catabolic factors interleukin‐1β (IL‐1β) (10 ng/ml) or H2O2 (100 μM), in the presence or absence of water‐soluble C60 (100 μM) under normoxic or hypoxic conditions for 48 hours. A, At the end of the incubation period, the concentration of proteoglycan was analyzed by enzyme‐linked immunosorbent assay. Bars show the mean and SD from 4 independent experiments. B, Production of type II collagen by chondrocytes, in the presence or absence of catabolic stress induced by IL‐1β and with or without various doses of C60, was studied by Western blotting under both normoxic and hypoxic conditions; β‐actin served as the control. C, Chondrocyte senescence was measured by the senescence‐associated β‐galactosidase (SA‐β‐Gal) activity assay in chondrocytes cultured with or without IL‐1β in the presence or absence of C60 for 5 days (original magnification × 200). D, IL‐1β–induced SA‐β‐Gal activity in the presence or absence of C60 was determined by counting the number of SA‐β‐Gal–positive chondrocytes per high‐power field. Bars show the mean and SD. ∗︁∗︁ = P < 0.01.

Western blot analysis also showed that C60 at 100 μM, but not at 0.1 μM, maintained the production of type II collagen in the cells subjected to catabolic stress by IL‐1β at 10 ng/ml. This dose‐dependent effect of C60 was evident under both normoxic and hypoxic conditions (Figure 2B).

Inhibitory effect of C60 on the catabolic factor–induced apoptosis of chondrocytes.

Chondrocyte apoptosis was significantly accelerated by treatment with IL‐1β, at a frequency twice that of control chondrocytes (mean percentage of apoptotic nuclei 27.5% in control group versus 61% in IL‐1β–stimulated group; P < 0.01). In the presence of C60 (100 μM), IL‐1β–treated chondrocytes showed a significantly decreased level of apoptosis compared with that of their control counterparts (mean percentage of apoptotic nuclei 61% in IL‐1β–stimulated group versus 38.8% in C60 plus IL‐1β–treated group; P < 0.01).

The phenotype of cells with stress‐induced senescence was characterized by SA‐β‐Gal activity in the cells. IL‐1β enhanced SA‐β‐Gal activity in the chondrocytes, whereas the IL‐1β–induced acceleration of SA‐β‐Gal activity was significantly inhibited in the presence of C60 (100 μM) (Figures 2C and D).

Prevention of OA cartilage degeneration by intraarticular injection of C60 in rabbit knee joints.

Rabbits were administered intraarticular injections of various doses of C60 into the knee joints. After 4 or 8 weeks of C60 treatment, the severity of cartilage damage was monitored.

In the control joints at the 4‐week and 8‐week time points, histologic features of cartilage degeneration were evident. Control cartilage exhibited an extension of the area of surface fibrillation, chondrocyte clustering, abnormal deposition of chondrocytes, reduction in proteoglycan staining, and a decreased cell density, as well as cartilage thinning (Figure 3). With the advance of time after ligament resection, the cartilage in the knees of rabbits that had received the control intraarticular injection of 50% PEG showed a progression of cartilage degeneration. Eight weeks after the ligament operation, most of the control cartilage showed a decrease in thickness, marked loss of proteoglycans, chondrocyte clustering, and cell death (Figures 3 and 4).

Representative images from histologic analysis of rabbit bone and cartilage tissue, showing degenerative changes of anterior cruciate ligament (ACL) transection–induced osteoarthritis in the left knee joints treated with 50% polyethylene glycol (as control) and right knee joints treated with different doses of C60 for 8 weeks. A, 1 μM C60–treated group. B, 10 μM C60–treated group. (Original magnification × 50; insets × 200.).

Articular cartilage lesion scores after 8 weeks of treatment with C60 in the rabbit model of osteoarthritis (OA). Each cartilage sample was evaluated histologically for the degree of degeneration according to the modified Mankin grading system (see Table 1). The severity of cartilage histologic lesions was inversely proportional to the dose of C60 injected (0.1–40 μM). Control joints were treated with 50% polyethylene glycol (PEG) or subjected to sham operation. Bars show the mean and SD. ∗︁∗︁ = P < 0.01.

In contrast, as shown in the representative images in Figure 3, treatment of the resected knee joints with C60 markedly inhibited the degeneration of articular cartilage in the rabbit model of OA. The severity of cartilage histologic lesions was inversely proportional to the dose of C60 injected. After 4 weeks of treatment with C60, although there were no significant differences in the severity of cartilage degeneration among the 4 different C60 dose groups, a tendency in the degree of cartilage degeneration was noted among the groups, with greater severity of cartilage damage after administration of the low doses of C60 (0.1 μM, 1 μM) than after the higher doses (10 μM, 40 μM) (results not shown).

After 8 weeks, mild cartilage damage was observed following administration of all doses of C60 (0.1–40 μM). In contrast, more severe damage was observed in all control joints treated with 50% PEG (Figures 3 and 4). At 8 weeks, the inhibitory effect of C60 on cartilage degeneration was superior in the high‐dose groups (10 μM, 40 μM) as compared with that in the low‐dose groups (0.1 μM, 1 μM) (Figure 4). No significant degeneration of the cartilage layer was observed in the sham‐operated groups, even after 8 weeks of treatment (Figure 4).

In comparison with the HA‐treated group, the C60‐treated group of rabbits with OA exhibited a markedly greater inhibition of cartilage degeneration, as shown in Figure 5. The inhibitory effect of C60 on cartilage degeneration (according to the modified Mankin scores for loss of Safranin O–fast green staining, loss of chondrocytes, and cartilage structure) was superior to that of HA alone (P < 0.01 between groups) (Figure 5). In addition, combined treatment with C60 and HA resulted in a significant reduction in cartilage degeneration in comparison with the effects of C60 alone (P < 0.05 between groups) (Figure 5).

Comparison of the therapeutic effects of C60 and sodium hyaluronate (HA) in the rabbit model of osteoarthritis (OA). Each cartilage sample was evaluated histologically for the degree of degeneration according to the modified Mankin grading system (see Table 1), after treatment with either 10 μM C60 or 5 mg/ml HA for 8 weeks. Control knee joints were treated with 50% polyethylene glycol (PEG) or subjected to sham operation. Bars show the mean and SD. ∗︁ = P < 0.01; ∗︁∗︁ = P < 0.05.

DISCUSSION

The study reported herein sought to demonstrate, in an animal model of OA in vitro and in vivo, that water‐soluble C60 fullerene can function as a protective agent against the catabolic stress–induced degeneration of articular cartilage. Our results indicate that water‐soluble C60 inhibits the following catabolic responses: the production of matrix‐degrading enzymes, the down‐regulated production of matrix proteins, cellular senescence, and apoptosis of OA chondrocytes stressed by the OA‐inducing factors IL‐1β and H2O2.

OA chondrocytes can be stimulated with several kinds of catabolic factors, such as mechanical and chemical factors, including proinflammatory cytokines. Even in the unstimulated chondrocytes in the control groups, the levels of MMPs produced were reduced by treatment with C60. In the present study we used OA human chondrocytes, but not normal human chondrocytes. The OA chondrocytes could be influenced by OA‐inducing factors, such as proinflammatory cytokines (including IL‐1β) and oxidative stress, as well as mechanical stress, in articular cartilage.

In addition, we found that C60 significantly reduced articular cartilage degeneration in a rabbit model of OA produced by resection of the joint ligament. We also compared the inhibitory effect of C60 on cartilage degeneration with that of HA in the rabbit model of OA. Hyaluronate, a component of glycoconjugates, shows high viscosity, has an important role in retaining moisture, and lubricates, coats, and protects joint functions (44, 45). Intraarticular injection with this agent is widely recognized as a treatment to improve joint function in OA (45).

In the present study, the inhibitory effect of C60 on cartilage degeneration was better than that of HA alone. Moreover, combined treatment with C60 and HA showed a tendency to be superior to treatment with C60 or HA alone. These findings suggest that C60 has an important property in conferring protection against catabolic stress–induced degeneration of articular cartilage in OA. Moreover, intraarticular treatment with C60 appears to be superior to treatment with existing drugs, such as HA. We therefore conclude that C60 is useful as a therapeutic agent to maintain the articular cartilage against degeneration in OA.

Oxygen‐derived free radicals directly injure numerous enzymes, membranes, or DNA molecules through a destructive chain reaction of chemical damage, leading to extensive cell injury and cell death. Endogenous cellular antioxidants, such as superoxide dismutase, catalase, glutathione, and vitamins C and E, are sufficient to inactivate the low levels of free radicals circulating under normal circumstances, but are inadequate to achieve a meaningful therapeutic impact in diseases that result in excess free radical production (31, 32). In aging and in certain disease states involving cartilage degeneration and inflammation, the levels of the endogenous cellular antioxidants decline and the free radicals may overwhelm these protection systems (32).

C60 fullerene, as a radical sponge, inactivates multiple circulating free radicals, thus having the potential to stop free radical injury and to halt the progression of diseases caused by excess free radical production (33-35). It is well known that C60 can effectively protect against all of the principal damaging forms of ROS: hydrogen peroxide, hydroxyl radical, and superoxide (35).

C60 fullerene has 30 conjugated carbon–carbon double bonds, all of which can react with a radical species. Several studies have demonstrated that C60, as a therapeutic antioxidant, works significantly better than other natural and synthetic antioxidants in degenerative diseases (36-40). It has been reported that carboxyfullerene protects human keratinocytes from apoptosis induced by exposure to oxidative stress (40). Our results also indicate that C60 fullerene may be a therapeutic agent, in that it is able to protect articular cartilage from the advancing forces of cartilage degeneration in OA. It is conceivable that fullerene protects the articular cartilage matrix, as well as chondrocytes, from oxidative stress caused by mechanical forces during the progression of OA, by acting as a free radical scavenger.

In the present study we used the rabbit model of OA, induced by transection of the medial meniscus and medial collateral ligament, to observe the effect of C60 on cartilage degeneration. It is well known that this type of OA model, involving transection of the joint ligaments, has been established and internationally recognized in this field (50, 51). In numerous studies, the joint transection model has been used for the study of OA. In the present study the model was suitable to examine the effect of C60 (intraarticular injection) on the development of OA. We chose the joint ligament transection model of OA in rabbits to ensure the accuracy of intraarticular treatment.

In addition to the ligament transection model, animal models of spontaneous, or natural, OA, including mouse and guinea pig models, have been reported to be useful to study the pathogenesis of OA and to discover, develop, and test new treatments (53-55). Indeed, in our previous study, mice with natural OA were treated orally, but not intraarticularly, with some agents. However, although it is possible to observe the typical pathologic features of OA (cartilage degeneration, osteophyte formation, consolidation of subchondral bone, joint space narrowing) in models of spontaneous OA, the disease in these types of models may not be completely representative of human OA. Male mice with natural OA, but not female mice with natural OA, have been reported to show the typical features of OA (53). This sexual distinction is not observed in human OA and, in fact, is not a typical feature of OA. Further studies involving more than one animal model may be needed to clarify the exact pathogenesis of OA.

Our findings thus indicate that water‐soluble C60 fullerene can function as a protective agent against catabolic stress–induced degeneration of articular cartilage. This compound significantly reduced catabolic activity in chondrocytes and protected against articular cartilage degeneration in the rabbit model of OA. These findings suggest that C60 fullerene may be useful as a therapeutic agent for the maintenance of articular cartilage and as a deterrent against the progression of cartilage degeneration in patients with OA.

AUTHOR CONTRIBUTIONS

Dr. Yudoh had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Study design. Yudoh, Masuko, Kato.

Acquisition of data. Yudoh, Nakamura, Masuko.

Analysis and interpretation of data. Yudoh, Nishioka.

Manuscript preparation. Yudoh, Shishido, Murayama, Yano, Matsubayashi, Takada.

Statistical analysis. Nakamura, Kato.

back